Growth Characteristic and the Study of Polymorphism Growth Hormone Genes of Sentul Chicken

The research was conducted to study the characteristics of growth, carcass production and growth hormone gene polymorphisms in various male sentul chickens. using experimental methods with a completely randomized design. material 100 day old chickens Sentul. treatment fixed factor, namely variation color feathers Sentul consisting of: “Abu” Sentul, “Emas” “Geni” “Debu” “Batu” Sentul.. Each unit consisted 5 4 replications. variables measured included: hatching weight, body weight gain percentage produced at age 8 weeks. Identification used primary design Gallus gallus haplotype GH-h22 (GH) gene, complete cds, GenBank: JN675393.1 forward primer / Sequence: AGGTGGTTCGGTTTTCACTG reverse TCCCTTCTTCCAGGTCCTTT. Characteristics data were analyzed by analysis variance; while determine presence GH bioedit program. Analysis variance showed that there no significant differences (P> 0.05) between results sequencing base length 80 bp mutation from adinine cytosine, when comparing GenBank. present monomorphic homozygous genotypes CC. this can be concluded are relatively same, as well gene.
 Keywords: chickens, percentage, monomorphic.